Pages

Subscribe:

Ads 468x60px

Sabtu, 14 April 2012

KLONING PENGANTAR BIOTEKNOLOGI PERTANIAN.


Untuk mempelajari kloning gen dibutuhkan penge -tahuan tentang konsep biologi molekuler dan peng -gunaan tehnik-tehnik dalam laboratorium

Teknologi DNA telah meluncurkan revolusi dalam bidang bioteknologi yaitu manipulasi organisme atau komponen organisme untuk melakukan tugas tugas praktis untuk menghasilkan produk yang bermanfaat.

Semuanya melibatkan para peneliti dari bidang a.l; biologi, mikrobiologi, biologi molekuler,dan para teknisi peralatan untuk menunjang kerja para peneliti.

Aplikasi DNA Rekombinan

Dalam Bidang Kedokteran

Dalam Bidang Farmasi

Dalam Bidang Forensik

Dalam Bidang Lingkungan

Dalam Bidang Pertanian

Dalam Bidang pangan

DNA REKOMBINAN (KLONING GEN)

KONJUGASI, TRANSFORMASI, TRANSDUKSI

Perpindahan molekul genetik dari satu sel bakteri ke sel bakteri lainnya secara kontak antar sel.

Sel donor akan memberikan informasi genetik kepada resipien.

Plasmid akan mengontrol formasi filamen permukaan sel yang dibutuhkan untuk mengadakan kontak pada waktu terjadinya perkawinan.

Konjugasi

Plasmid memiliki sistim khusus untuk replikasi dan transfer DNA plasmid dan sistem pengontrolan

Plasmid memiliki faktor F yang merupakan faktor konjugatif ,

Konjugasi

Transformasi

Prosesperpindahan genetik dimana sel resipien membutuhkan molekul DNA bebas ( DNA yang berada diluar sel atau yang telah dimurnikan.

Dalam laboratorium transformasi dapat dilakukan dengan mengisolasi DNA donor kemudian menambahkannya pada suspensi selresipien.

Transformasi dapat terjadi secara alami.

Pada prinsipnya transformasi akan terjadi bila sel resipien mampu menerima DNA yang telah diisolasi dari sel donor.

Transformasi dapat terjadi pada bakteri Gram positif ataupun Gram negatif

Transformasi dapat dipindahkan dari sel bakteri kepada sel tanaman.

Transformasi

Transduksi

Adalah transfer genetik dari sel ke sel oleh virus dari sel inang .

Transduksi terbagi 2

Tranduksi Khusus : hanya terjadi pada beberapa virus tertentu.gen inang langsung diintegrasi kedalam genomvirus.lalu ditransfer ke resipien selama proses lisogenisasi (pembentukan lisogen )

Lisogen adalah bakteri yang mengandung faga lengkap

Transduksi umum : gen gen inang yang berasal dari suatu genom akan menjadi bagian dari partikel DNA virus yang sudah matang darisuatu tempat atau penambahan pada genom virus.

Virus yang telah mengalami transduksi tidak mampu melisiskan inang. Hal ini disebabkan sel bakteri telah menggantikan tempat penting pada gen virus.

Transduksi

KLONING DNA

ENZIM RESTRIKSI (enzim pemotong)

KLONING VEKTOR (pembawa)

ENZIM LIGASE yang berfungsi menyambung rantai DNA, dan enzim lain, seperti alkalin fosfatase, DNA polimerase, reverse transkriptase, dan polinukleotida kinase

KOMPONEN UNTUK KLONING DNA

Pemotongan DNA (DNA organisme yang diteliti dan DNA vektor) dengan enzim restriksi

Penyambungan potongan-potongan (fragmen) DNA organisme dengan DNA vektor menggunakan enzim ligase

Transformasi rekombinan DNA (vektor + DNA sisipan) dalam sel bakteri Escherichia coli

Seleksi untuk mendapatkan klon DNA yang diinginkan

PROSES DASAR KLONING DNA

ENZIM RESTRIKSI

▲ Adalah : Enzim yang dapat mengkatalisasi pembelahan / pe

motongan DNA dibeberapa tempat / lokasi spesifik

dengan jumlah yang terbatas & dapat direproduksi.

▲ Enzim ini disebut juga dengan nama endonuklease restriksi

( Russell, 1980).

▲ Semua enzim ini mampu memecah ikatan fosfodiester asam nukleat umumnya berupa tangga, karena urutan target umumnya sering muncul berkali kali.

▲ fragmen enzim restriksi berupa DNA untai ganda dengan sedikitnya satu ujung untai tunggal.

Stewart Linn & Werner Arber (1960)

Menemukan : Enzim modifikasi maupun enzim nuklease “restriksi” dalam bakteri E.coli galur B yang dapat menguraikan DNA yang tidak termetilkan.




Hamilton Smith (1970)

Pertama kali menemukan enzim nuklease restriksi spesifik yang memutus DNA pada tempat- tempat tertentu dan dapat diidentifikasikan, dari Haemophilus influenzae yang dikenal dengan nama HindII,

SEJARAH PENEMUAN ENZIM RESTRIKSI

Watson dkk, (1983)

Menemukan nuklease restriksi & metilase modifikasi dalam dua galur E.coli lain yang membuka kemungkinan adanya banyak nuklease yang spesifik untuk suatu tempat

SEJARAH PENEMUAN ENZIM RESTRIKSI

ENZIM RESTRIKSI

Disebut endonuklease

Memotong rantai ganda DNA pada tempat tertentu

Cara kerjanya dengan mengenal sekuens (urutan basa) tertentu pada DNA, lalu melakukan pemotongan

Sekuens pengenal berbeda antara satu enzim restriksi dengan yang lain

Lebih dari 200 enzim restriksi telah diidentifikasi dan diisolasi

Enzim restriksi golongan I bekerja dengan mengenal sekuens tertentu pada DNA, tetapi melakukan pemotongan di luar (disekitar) sekuens pengenal tersebut

Enzim restriksi golongan II, memotong DNA pada posisi tertentu di dalam sekuens pengenal

Enzim restriksi golongan III, pemotongan tidak spesifik dilakukan di sekitar sekuens pengenal

ENZIM RESTRIKSI

GOLONGAN ENZIM RESTRIKSI

ENZIM RESTRIKSI

Nama enzim restriksi diambil dari nama bakteri asal enzim tersebut diisolasi

Bakteri umumnya mensintesis satu atau lebih endonuklease yang dapat memotong DNA

Endonuklease atau enzim restriksi berfungsi terutama menghalangi adanya DNA-DNA asing yang masuk ke dalam sel bakteri tersebut

DNA dari sel yang mensintesis enzim restriksi itu sendiri terlindungi dari aksi enzim restriksinya karena sel tersebut juga mensintesis enzim modifikasi yang merubah struktur dari sekuens pengenal enzim restriksi

ENZIM RESTRIKSI

Contoh enzim restriksi, organisme asal mereka diisolasi, dan sekuens pengenal

Nama

Mikroorganisme Asal

Sekuens Pengenal

AluI

Arthrobacter luteus

A – G – C – T

T – C – G – A

BamHI

Bacillus amyloliquefaciens H

G – G – A – T – C – C

C – C – T – A – G – G

EcoRI

Escherichia coli RY13

G – A – A – T – T – C

C – T – T – A – A – G

HaeIII

Haemophilus aegiptius

G – G – C – C

C – C – G – G

PvuII

Proteus vulgaris

C – A – G – C – T – G

G – T – C – G – A – C

SalI

Streptomyces albus G

G – T – C – G – A – C

C – A – G – C – T – G

SmaI

Serratia marcescenc Sb

C - C – C – G – G – G

G – G – G – C – C – C

HindIII

Haemophilus influenzae Rd

A – A – G – C – T – T

T – T – C – G – A – A

ENZIM RESTRIKSI

SEKUENS PENGENAL ENZIM RESTRIKSI YANG TELAH DIKETAHUI ADA 4, 6, DAN 8 PASANG BASA

CIRI LAIN SEKUENS PENGENAL ENZIM RESTRIKSI ADALAH SIFATNYA YANG PALINDROMIK (JIKA DITARIK GARIS SUMBU DI TENGAH-TENGAH SEKUENS PENGENAL, MAKA URUTAN BASANYA SIMETRI

SEKUEN PENGENAL

BamHI 5’ -------G * G – A – T – C – C --------------------------- 3’

3’ -------C – C – T – A – G * G --------------------------- 5’

EcoRI 5’ -------G * A – A – T – T – C --------------------------- 3’

3’ -------C – T – T – A – A * G --------------------------- 5’

HaeIII 5’ ------------------ G – G – C – C --------------------------- 3’

3’ ------------------ C – C – G * G --------------------------- 5’




SEKUEN PENGENAL

ENZIM RESTRIKSI

ENZIM RESTRIKSI

ENZIM RESTRIKSI MEMOTONG IKATAN FOSFODIESTER PADA TULANG PUNGGUNG RANTAI DNA

HASIL PEMOTONGAN ADALAHRANTAI DNA BERUJUNG GUGUS FOSFAT DAN UJUNG LAINNYA OH

UJUNG HASIL PEMOTONGAN: 1) UJUNG LENGKET (STICKY END) DAN 2) UJUNG TUMPUL (BLUNT END)

SEKUEN PENGENAL

EcoRI 5’ -------G * A – A – T – T – C --------------------------- 3’

3’ -------C – T – T – A – A * G --------------------------- 5’




5’ -------GOH PA – A – T – T – C ----------------------- 3’

3’ -------C – T – T – A – AP OHG ----------------------- 5’

SmaI 5’ -------C – C – C * G – G – G --------------------------- 3’

3’ -------G – G – G * C – C – C --------------------------- 5’




5’ -------C – C – COH PG – G – G ----------------------- 3’

3’ -------G – G – GP OHC – C – C ----------------------- 5’

SEKUEN PENGENAL

ENZIM RESTRIKSI

Gbr. Pemisahan DNA oleh enzim restriksi

VEKTOR / WAHANA KLONING

♦ SEUTAS MOLEKUL DNA TUNGGAL TEMPAT DILEKATKANNYA MATERIAL GENETIK YANG KITA INGINKAN SEBELUM DI INJEKSIKAN ATAUPUN DITRANSFORMASIKAN KEDALAM BAKTERI TERTENTU.

♦ WAHANA KLONING YANG PALING SERING DI GUNAKAN ADALAH PLASMID.




VEKTOR KLONING

VEKTOR KLONING

MOLEKUL DNA YANG DIPERLUKAN UNTUK MEMBAWA DAN SEKALIGUS MEMPERBANYAK DNA YANG DIBAWANYA

PLASMID MERUPAKAN SALAH SATU JENIS VEKTOR YANG PALING BANYAK DIGUNAKAN

PLASMID ADALAH MOLEKUL DNA UTAS GANDA, BENTUK MELINGKAR, BERADA DI LUAR KROMOSOM SEL

PLASMID DI ALAM BERUKURAN 1 KILO BASA (1000 PASANG BASA) S/D 200 KILO BASA

CIRI KHAS PLASMID ADALAH MEMPUNYAI ORI (ORIGIN OF REPLICATION), YAITU SITUS UNTUK MEMULAI REPLIKASINYA SENDIRI, SEHINGGA DALAM SEL MAMPU BEREPLIKASI/MENGGANDAKAN DIRI SENDIRI

BERDASARKAN SISTEM REPLIKASI ADA 2 GOLONGAN PLASMID: 1) REPLIKASI DI BAWAH KONTROL KETAT (STRINGENT CONTROL) DAN 2) REPLIKASI TERKONTROL SECARA LONGGAR/RILEKS (RELAXED CONTROL)

PLASMID YANG REPLIKASINYA DI BAWAH KONTROL KETAT REPLIKASINYA BERTEPATAN DENGAN REPLIKASI KROMOSOM SEL INANG

PLASMID YANG REPLIKASINYA TERKONTROL SECARA LONGGAR/RILEKS REPLIKASINYA INDEPENDEN DARI REPLIKASI KROMOSOM SEL INANG.

VEKTOR KLONING

VEKTOR KLONING

PLASMID YANG SEKARANG BANYAK DIPAKAI ADALAH PLASMID YANG TELAH DIMODIFIKASI (REKONSTRUKSI, DITAMBAH, DIKURANGI) SIFAT-SIFAT TERTENTU YG DAPAT MEMUDAHKAN PEKERJAAN KLONING DNA

PLASMID YANG BANYAK DIGUNAKAN ADALAH PLASMID YANG REPLIKASINYA SECARA LONGGAR, BERUKURAN RELATIF KECIL (2000 – 4000 PASANG BASA)

PLASMID BANYAK DIGUNAKAN DALAM KLONING DNA KARENA: 1) MUDAH DIMANIPULASI; 2) KUANTITASNYA BANYAK; 3) MEMPUNYAI MARKER UNTUK SELEKSI

KARAKTERISTIK PENTING PLASMID: 1) MEMPUNYAI ORI; 2) MEMPUNYAI MARKER SELEKSI (SELECTABLE MARKER); 3) MEMPUNYAI SITUS UNTUK KLONING (CLONING SITES)

VEKTOR KLONING

MARKER SELEKSI BERGUNA UNTUK PROSES SELEKSI, YAITU TAHAP UNTUK MENYELEKSI PLASMID YANG MEMBAWA DNA SISIPAN (REKOMBINAN) DARI PLASMID YANG TIDAK DISISIPI DNA ASING. MARKER SELEKSI YANG UMUM ADALAH GEN RESISTENSI TERHADAP ANTIBIOTIKA, MISALNYA AMPISILIN ATAU TETRASIKLIN

SITUS KLONING ADALAH TEMPAT/LOKASI DIMANA FRAGMEN DNA YANG AKAN DIKLON/GANDAKAN DIMASUKKAN/ DISISIPKAN UNTUK KEMUDIAN DIGANDAKAN OLEH PLASMID

SITUS KLONING ADALAH SATU SEGMEN PADA PLASMID YANG PANJANGNYA BEBERAPA PULUH SAMPAI RATUSAN PASANG BASA YANG TERDAPAT SEKUENS PENGENAL UNTUK BEBERAPA ENZIM RESTRIKSI

SEKUENS PENGENAL UNTUK ENZIM RESTRIKSI YANG ADA PADA SEGMEN SITUS KLONING INI HARUS SATU-SATUNYA DI TEMPAT ITU (TIDAK BOLEH ADA PADA BAGIAN LAIN DI SEKELILING MOLEKUL PLASMID)

PLASMID

ADALAH UNSUR GENETIK DILUAR KROMOSOM (EKSTRAKROMOSOMAL), YANG MENGADAKAN REPLIKASI SECARA AUTONOM DI DALAM SEL BAKTERI.

DNANYA BERBENTUK LINGKARAN DAN BERUNTAI GANDA.

MENDUKUNG GEN YANG DIPERLUKAN UNTUK REPLIKASI ATAUPUN FUNGSI LAIN YANG DIPIKULNYA.

PLASMID MUDAH DIPISAHKAN DAN DIMURNIKAN DARI DNA INANG

PADA RHIZOBIUM SP. PLASMID BERGUNA KARENA TERLIBAT DALAM PROSES FIKSASI DAN UNTUK MENGIKAT NITROGEN.




ADALAH MOLEKUL YANG DAPAT DITURUNKAN SECARA STABIL TANPA MENGKAITKANNYA DENGAN KROMOSOM.

SANGAT BERARTI BAGI BIDANG KEDOKTERAN , FARMASI, DAN PERTANIAN , KARENA PLASMID MEMBAWA RESISTEN TERHA DAP ANTIBIOTIK YANG BERGUNA BAGI MANUSIA DAN HEWAN.

SELAIN ITU DAPAT MENJANDIKAN TOKSIN DAN PROTEIN LAIN YANG DAPAT MENINGKATKAN VIRULENSI PATOGEN.

PLASMID

JENIS PLASMID

PLASMID F : BERFUNGSI DALAM PROSES KONJUGASI DAN DIKENAL PADA BERBAGAI BAKTERI.

PLASMID FAKTOR R : PLASMID YANG MEMBAWA GEN-GEN PENYEBAB RESISTENSI TERHADAP ANTIBIOTIK.

PLASMID TI :

PADA BERBAGAI AGROBACTERIUM

FUNGSI BERHUBUNGAN DENGAN TUMBUHAN INANG, YAITU DENGAN CARA MENTRANSFER SATU FRAGMEN DNA (DNA-T) KEDALAM SEL INANG, YANG KEMUDIAN AKAN MENYEBABKAN TUMBUHNYA TUMOR PADA INANG.

PLASMID

FUNGSI PLASMID

Mendukung replikasi

Sebagai vektor untuk pengklonan DNa

Pembawa gen resisten antibiotik ( plasma resisten )

Contoh : plasmid resisten  p BR. 322.( plasmid R.E Coli,

yaitu : plasmid yang memberi resisten terhadap

ampicilin dan tetrasiklin. )

♦ DNA plasmid dapat diisolasi dengan cara “melisiskan” sel bakteri dan memisahkan DNA plasmid dari DNA kromosom.

♦ Plasmid p.BR.322 : merupakan suatu determinan replikasi plasmid pMBI yang berkaitan dengan col.E.I. gen plasmid RI ( TN3) resisten dan gen resisten tetrasiklin plasmid pS (101) sebagai penanda seleksi.

PLASMID

PETA PLASMID

BAKTERI, BERPERAN DALAM PERBANYAKAN PLASMID MELALUI PERBANYAKAN BAKTERI

PEMINDAHAN PLASMID KEDALAM GEN

SITUS KLONING PADA PLASMID PUC19

Amp

pUC19

HaeII

HaeII

HaeII

GAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGGC

PstI

AccI

EcoRI

Hindiii

SphI

XbaI

BamHI

KpnI

SmaI

SalI

ENZIM LAIN DALAM KLONING

LIGASE ADALAH ENZIM YANG DIKETAHUI BEKERJA MENYAMBUNG FRAGMEN-FRAGMEN OKAZAKI PADA PERPANJANGAN UTAS LAGGING (LAGGING STRAND) DALAM REPLIKASI DNA

DALAM PROSEDUR KLONING DNA, LIGASE DIPERLUKAN UNTUK MENYAMBUNG FRAGMEN-FRAGMEN DNA YANG AKAN DIKLON DENGAN DNA VEKTOR

LIGASE MEMBUAT IKATAN FOSFODIESTER ANTARA OH DAN GUGUS P PADA UJUNG RANTAI DNA

ALKALINE PHOSPHATASE ADALAH ENZIM YANG DIGUNAKAN UNTUK MENGGANTIKAN GUGUS FOSFAT PADA SATU UJUNG DNA DENGAN GUGUS OH SEHINGGA MOLEKUL VEKTOR TIDAK DAPAT BERSIRKULASI SENDIRI

DNA POLYMERASE

POLINUKLEOTIDA KINASE

KULIAH KE-2

PROSES DASAR KLONING DNA

PROSES DASAR KLONING DNA

KLONING DNA PADA DASARNYA ADALAH MENGISOLASI DAN MENGGANDAKAN MOLEKUL DNA

1

3

2

4

Pemotongan DNA – enzim restriksi

Ligasi DNA fragmen dengan vektor

Transformasi DNA rekombinan ke E coli

Seleksi

Skema Proses Dasar Kloning DNA

PROSES DASAR KLONING DNA

SETELAH ISOLASI DAN PEMOTONGAN DNA DENGAN ENZIM RESTRIKSI, FRAGMEN-FRAGMEN DNA KEMUDIAN DISISIPKAN KEDALAM VEKTOR DENGAN MENGGUNAKAN ENZIM LIGASE (PROSESNYA DISEBUT LIGASI)

UNTUK MENINGKATKAN EFISIENSI PROSES SELEKSI DALAM TAHAP-TAHAP BERIKUTNYA, SEBELUM LIGASI, DNA VEKTOR YANG TELAH DIPOTONG ENZIM RESTRIKSI DIPERLAKUKAN DENGAN ALKALINE PHOSPHATASE

HASIL DARI PENYAMBUNGAN, YAITU KIMERA/KOMBINASI VEKTOR DENGAN DNA FRAGMEN DISEBUT MOLEKUL DNA REKOMBINAN

POPULASI DNA REKOMBINAN DENGAN FRAGMEN YANG BERBEDA-BEDA PADA MOLEKUL VEKTOR DISEBUT PUSTAKA (LIBRARY)

MOLEKUL DNA REKOMBINAN DITRANSFORMASI KE E COLI YANG KEMUDIAN DISEBARKAN DI DALAM PETRIDIS

MASING-MASING SEL E COLI YANG MENGANDUNG DNA REKOMBINAN AKAN TERUS MEMBELAH DIRI, SEHINGGA MASING-MASING MOLEKUL REKOMBINAN DIPERBANYAK (DIKLON)

DISAMPING ITU, MOLEKUL PLASMID VEKTOR YANG ADA DALAM SEL JUGA BEREPLIKASI, SEHINGGA DALAM SATU SEL TERDAPAT PERBANYAKAN KOPI MELEKUL DNA REKOMBINAN

SEHINGGA ADA DUA PERBANYAKAN. PELIPATGANDAAN MOLEKUL REKOMBINAN TERSEBUT DINAMAKAN KLONING DNA

SELEKSI ADALAH PROSES MENDAPATKAN DNA REKOMBINAN YANG MENGANDUNG FRAGMEN DNA SISIPAN YANG DIINGINKAN DIANTARA POPULASI REKOMBINAN (PUSTAKA) YANG ADA

SELEKSI MERUPAKAN TAHAPAN YANG PERLU USAHA PALING BANYAK DAN SULIT. UNTUK ITU PERLU STRATEGI DALAM PROGRAM KLONING DNA

PROSES DASAR KLONING DNA

Penyambungan DNA Fragmen Ke Dalam Plasmid

Dapat ditransformasi ke sel E. coli

dengan efisiensi tinggi

Efisiensi transformasi masih sangat rendah

Plasmid

DNA Asing

Phosphatase

DNA Ligase

EcoRI

Tidak dapat melingkar sendiri

OH

OH

OH

OH

OH

OH

OH

OH

OH

OH

OH

OH

OH

OH

OH

OH

P

P

P

P

KLONING GEN

Strategi Dalam Kloning DNA

Dalam rekayasa genetika, fragmen yang akan diklon adalah fragmen yang punya nilai strategis

Fragmen DNA yang diinginkan dapat berupa gen yang aktif mengendalikan sifat tertentu atau klon-klon DNA lain yang akan digunakan sebagai marker

Gen yang aktif berekspresi bekerja melalui pembuatan cetak mRNA, yang kemudian ditranslasi menjadi protein (enzim)

Transkripsi Translasi

DNA mRNA Protein

Transkripsi balik

Proses dasar genetik di atas yang banyak mendasari strategi dalam program kloning DNA

Program kloning DNA umumnya dimulai dengan mengisolasi mRNA dari tanaman

Dari mRNA yang berutas tunggal kemudian dibuat cetak DNA utas ganda yang disebut cDNA (complementary DNA)

Sintesis cDNA dari mRNA dikatalisis oleh enzim reverse transkriptase

cDNA lalu diligasi kedalam vektor, ditransformasi ke E coli untuk kemudian diseleksi

Populasi cDNA yang telah disisipkan ke dalam vektor dan ditransformasikan ke dalam sel E coli disebut pustaka cDNA (cDNA library)

Strategi Dalam Kloning DNA

Pustaka cDNA lebih menguntungkan daripada pustaka genom, karena diturunkan dari mRNA, sehingga hanya terdiri atas populasi sekuens-sekuens DNA yang aktif mengkode protein

Pustaka genom dibuat dari seluruh populasi fragmen DNA, sehingga selain mengandung sekuens yang berekspresi, juga ada sekuens lain, seperti sekuens kopi berulang

Strategi kloning DNA perlu disesuaikan dengan kondisi yang ada. Bila DNA yang ingin diklon berupa gen aktif yang mengkode protein, kondisi berbeda tersebut dapat berupa:

1) Protein atau produk dari gen yang diinginkan diketahui atau telah ada informasi tentang proteinnya

2) Protein belum diketahui atau tidak ada informasi tentang proteinnya

Kondisi berbeda tersebut memberikan implikasi pada strategi kloning, baik awal isolasi mRNA atau DNA, maupun pada proses seleksi pustaka

Bila protein telah diketahui, maka untuk mengklon gen dapat dimanfaatkan informasi tentang protein tadi, yaitu menganalisis sekuens asam amino dari protein tersebut, lalu mendeduksi dan mensintesis oligonukleotida kodonnya untuk digunakan sebagai probe dalam menyeleksi pustaka yang dibuat.

Strategi Dalam Kloning DNA

(6) (2) (4) (1) (4) (2) (2) (4) (2) (6)

NH2 ------- Leu Lys Gly Met Ala Glu His Val Tyr Arg ------ COOH

ujung amino ujung karboksilat

U

A A U U

(mRNA) 5’ AUG GCG GAG CAC GUA UA 3’

C G

C

A

T T A A

(DNA) 3’ TAC CGC CTC GTC CAT AT 5’

G C

G

A

B

C

Misal dari analisis sekuens asam amino, satu segmennya seperti di atas (A)

Dari rantai polipeptida, dipilih segmen yang punya kombinasi kodon Wobble yang paling sedikit (garis bawah)

mRNA yang mengkode polipeptida dapat dideduksi (B)

Kodon metionin (Met) satu (AUG), kodon alanin (Ala) ada 4 kemungkinan (GCU, GCA, GCG, GCC), kodon glutamin (Glu) ada 2 kemungkinan (GAA dan GAG)

Dari segmen polipeptida yang digarisbawahi ada 64 kemungkinan komposisi kodon mRNA

Dari sekuens mRNA lalu disintesis sekuens DNA komplementernya [C], yang kemudian digunakan sebagai probe untuk menyeleksi pustaka yang dibuat

Karena rantai DNA yang disintesis tersebut diturunkan dari urutan asam amino, maka sekuens tersebut akan sama dengan sekuens pada segmen kecil dari gennya.

Untaian DNA yang disintesis dari deduksi sekuens asam amino untuk kemudian dipakai sebagai probe dinamakan probe oligonukleotida

Strategi Dalam Kloning DNA

Bila tidak ada informasi yang diketahui tentang protein produk dari gen, maka ada beberapa pendekatan yang dapat dilakukan dalam proses kloning gen

Langkah awal yang bisa dijajagi adalah dengan menggunakan probe heterologous untuk menyeleksi pustaka yang dibuat

Hal ini dapat dilakukan bila gen sejenis dengan yang kita inginkan telah ditemukan atau diklon orang pada species tanaman lain

Contoh untuk mengklon gen waxy (wx) pada padi dapat digunakan klon gen waxy dari jagung (bila sebelumnya telah diklon)

Keberhasilan pemakaian probe heterologous bergantung pada jarak kekerabatan organisme

Strategi lain adalah Differential Screening. Pendekatan ini memanfaatkan prinsip dasar genetika tentang ekspresi gen, yaitu bahwa gen berekspresi dengan memproduksi mRNA

Disamping itu, prinsip ini berdasarkan pemahaman bahwa gen-gen tertentu akan berekspresi oleh stimulasi/induksi dari lingkungan

Prinsip dasar differential screening adalah gen yang diinginkan untuk berekspresi, lalu mRNA diisolasi untuk membuat pustaka cDNA yang kemudian diseleksi untuk mendapatkan gen khusus yang berekspresi oleh adanya induksi

Dalam seleksinya, metode ini dibantu dengan sintesis cDNA lain yang dibuat paralel, tetapi dari tanaman yang tidak diinduksi

Strategi Differential Screening

Tanaman Diberi Auksin

Tanaman Tidak Diberi Auksin

Isolasi Poli mRNA

Isolasi Poli mRNA

Sintesis cDNA

Sintesis cDNA

Ligasi ke Vektor dan

Transformasi Sel E. coli

Label cDNA (Probe)

Label cDNA (Probe)

Pustaka cDNA dalam Sel E. coli

Replika

Replika

Diprobe dengan cDNA

Yang Diinduksi Auksin

Diprobe dengan cDNA

Yang Tidak Diberi Auksin

X-ray Film

X-ray Film

Kandidat Klon Gen yang

Ekspresinya Diregulasi Auksin

Strategi Differential Screening

Tanaman Diberi Auksin

Tanaman Tidak Diberi Auksin

Poli mRNA

Sintesis cDNA

Ligasi dan

Transformasi

Label cDNA (Probe) - B

Auksin Spesifik mRNA

Pustaka cDNA

Replika dan

Membran Blot

X-ray Film

Posisi Koloni yang Mengandung Kandidat

Klon Gen Responsif terhadap Auksin

Label cDNA (Probe) - A

Probe

dengan A

Probe

dengan B

Strategi Metode PERT

Strategi/pendekatan lain adalah metode PERT - phenol emulsion reassosiation tenique

Prosedur PERT dimulai dengan mengisolasi DNA genom dari individu yang mempunyai kromosom lengkap (A) dan dari individu yang kromosomnya terdelesi (B)

DNA yang diisolasi dari A dipotong dengan enzim restriksi sehingga potongan yang dihasilkan mempunyai ujung lengket

DNA yang diisolasi dari B dipotong/dohancurkan dengan cara mekanis, misal dengan sonifikasi (getaran frekuensi tinggi), sehingga DNA hancur menjadi fragmen potongan kecil dengan ujung fragmen terputus acak tidak beraturan

DNA A dan B didenaturasi dan kemudian dihibridisasi

Dalam pencampuran perlu dilakukan adalah jumlah DNA B dicampurkan lebih banyak daripada DNA A (misal 100 x lebih banyak)

Intri strategi PERT: 1) ujung fragmen hasil pemotongan dan 2) kuantitas DNA yang dicampurkan saat hibridisasi

Dalam proses hibridisasi, sekuens DNA A yang punya sekuens komplementer dengan DNA B sebagian besar akan cepat berhibridisasi, karena jumlah DNA B yang banyak dalam larutan

DNA yang spesifik yang hanya ada dalam genom A dan tak ada di genom B, dalam waktu cukup lama akan berhibridisasi dengan utas pasangannya sendiri

Strategi Metode PERT

Hibridisasi dalam emulsi phenol akan menghasilkan 3 macam DNA utas ganda berdasarkan komposisi basa yang ada di ujung fragmennya:

1) fragmen yang ujungnya bekas putus mekanis (hasil hibridisasi sesama fragmen dari genom B)

2) Fragmen-fragmen yang satu utas bekas putus mekanis dan utas lainnya bekas pemotongan enzim (hasil hibridisasi A dan B)

3) Fragmen-fragmen yang ujung kedua utasnya merupakan hasil dari pe- motongan enzim restriksi (hasil hibridisasi sesama fragmen dari genom A)

Dalam proses selanjutnya (penyisipan fragmen DNA ke dalam vektor), fragmen 1 dan 2 tidak diterima oleh vektor karena ujungnya tidak dikenal oleh vektor dan tidak kompatibel untuk disambung

Hanya fragmen-fragmen dari golongan 3 yang dapat berligasi dengan vektor

DNA sisipan yang ada dalam pustaka hanya DNA-DNA dari jenis 3, dimana probabilitas sekuens spesifik yang dicari akan sangat besar porsinya

Pekerjaan seleksi diharapkan menjadi lebih mudah untuk mendapatkan klon yang diinginkan

Strategi Metode PERT

Individu Kromosom Lengkap

(Tanaman Spesies Liar) – A

Individu Kromosom Terdelesi

(Tanaman Terbudidaya) - B

Isolasi DNA Genom

Isolasi DNA Genom

Pemotongan dengan Enzim Restriksi

Pemotongan Mekanis (Sonifikasi)

Denaturasi

Denaturasi

Hibridisasi DNA Kedua Genom

Pada Emulsi Phenol

(Jumlah DNA B 100 DNA A)

Penyiapan Vektor

dengan

Enzim Restriksi

Replika

Replika

Seleksi dengan Menggunakan

Probe DNA Genom

Ligasi Kedalam Vektor

dan Transformasi

Strategi Metode PERT

Penyiapan Vektor dengan

Enzim Restriksi

DNA Padi Liar

(O. minuta)

DNA Padi Terbudidaya

(O. sativa)

Pemotongan dengan

Enzim Restriksi

Denaturasi

Hibridisasi Dalam

Emulsi Phenol

Transformasi

dan Seleksi

Sekuens spesifik

O. minuta yang dicari

Ligasi

BGMN. TRANSGENIK DIBUAT:
Riset Lab dan Lapangan bertahap.

Identifikasi sifat/karakter yg diinginkan

Identifikasi sumber gen

Isolasi gen dari sumbernya

Transfer gen ke tanaman/varietas sasaran

Uji karakter yg diinginkan: terekspresi?

Jika tdk, kembali ke langkah 4

BGMN. TRANSGENIK DIBUAT:
Riset Lab dan Lapangan bertahap.

Jika terekspresi,

Yakinkan bahwa tidak ada efek merusak

Gen berfungsi sbgmn diinginkan

Integrasi dg Pemuliaan Konvensional/ Pd waktu sama dg no. 7, lakukan Uji keamanan produk

Ajukan informasi ke Komisi Keamanan Hayati

UJI BIOSAFETY/FOOD SAFETY

RESISTENSI TANAMAN TERHADAP VIRUS

Target resistensi virus:

1) memberikan resistensi terhadap transmisi (resistensi terhadap vektor, nonpreferensi vektor, resistensi terhadap transmisi benih)

2) resistensi untuk perkembangan penyakit (pencegahan replikasi virus, pencegahan penyebaran virus dari sel ke sel lainnya dalam tanaman)

3) resistensi terhadap perkembangan gejala penyakit (toleran)

Hambatan pemuliaan konvensional adalah sulitnya mencari sumber gen. Gen resistensi kerapkali ditemukan pada kerabat liar, akan tetapi ada masalah dengan kompatibilitas (gen resistensi tidak termanfaatkan)

Hambatan lain, resistensi yang didapat kerapkali hancur kembali karena resistensi dikendalikan oleh satu gen. Contoh ketahanan padi terhadap virus tungro yang telah diperoleh melalui resistensi terhadap vektornya, tetapi resistensi hancur dengan adanya biotipe baru vektor tersebut

Pendekatan lain, teknologi rekombinan DNA. Sanford dan Johnston (1985) memperkenalkan konsep baru penggunaan rekayasa genetika dalam mengembangkan resistensi terhadap mikroorganisme. Mereka menyarankan bahwa gen yang sudah dimodifikasi dari suatu patogen dapat memberikan resistensi tanaman dengan mengganggu proses hidup patogen tersebut (resistensi nonkonvensional terhadap penakit virus tanaman)

RESISTENSI TANAMAN TERHADAP VIRUS

Ada tiga bentuk resistensi nonkonvensional terhadap virus yang sudah dicobakan: 1) penggunaan sekuens RNA satelit, 2) sekuens RNA antisense, 3) gen penyandi protein pembungkus virus (virus coat protein gene – gen VCP)

RNA satelit adalah RNA berukuran kecil yang dapat bereplikasi menjadi sangat banyak. Tidak diperlukan dalam perbanyakan partikel virus dan tidak mempunyai homologi sekuens dengan RNA genom virus.

Ekspresi RNA satelit virus dalam tanaman transgenik menunjukkan penurunan gejala serangan virusnya sendiri. Pada beberapa kasus, menurunkan laju replikasi virus

Perlindungan tanaman menggunakan sekuens satelit ini spesifik hanya terhadap jenis virus asalnya

Sekuens RNA antisens virus digunakan untuk mendapatkan resistensi terhadap serangan virus pada tanaman belum banyak dilaporkan. Dari laporan yang ada belum terlihat keberhasilan yang konsisten

Gen panyandi protein pembungkus virus telah dibuktikan efektif memberikan proteksi terhadap serangan beberapa jenis virus

Metode yang dilakukan adalah dengan mengklon gen virus yang menyandi protein pembungkus partikel virus tersebut. Gen ini digabungkan dengan suatu sekuens pengendali (promotor) dan ditransformasikan ke dalam tanaman

Bila gen VCP diekspresikan, maka dalam tanaman akan terjadi akumulasi protein pembungkus virus. Telah terbukti bahwa resistensi tembakau terhadap TMV disebabkan oleh akumulasi protein pembungkus, bukan karena RNA transkripnya

Studi menunjukkan bahwa mekanisme resistensi tersebut berperan pada tingkat awal proses replikasi virus, dengan menghalangi proses replikasi virus secara tak terkendali dari partikel virus

RESISTENSI TANAMAN TERHADAP HERBISIDA

Herbisida digunakan untuk menekan pertumbuhan gulma pada tanaman pertanian

Herbisida sekarang memiliki gabungan sifat yang menguntungkan, seperti: efektifitas tinggi, tidak toksik, dan mengalami biodegradasi cepa. Namun, sering tidak memiliki selektivitas, sehingga menghalangi penggunaannya secara preemergence

Cara kerja herbisida satu dengan lainnya berbeda cara kerjanya.

Herbisida menghambat proses fotosintesis. Contohnya kelompok Atrazin dan Bromoxynil. Kelompok herbisida ini membunuh gulma dengan cara mengganggu transpor elektron fotosintesis dapa fotosistem II, dengan mengganggu pengikatan plastoquinon pada protein QB, yaitu suatu protein hidrofobik yang melekat pada membran tilakoid kloroplas. Protein tersebut dihasilkan oleh gen psbA, sebuah gen yang ada di kloroplas

Herbisida menghambat biosintesis asam amino. Contohnya glyphosate, phosphinotricin, sulfonylurea, imidazolinon

Glyphosate adalah jenis herbisida yang sekarang paling banyak digunakan, tidak beracun bagi hewan, dan dapat segera terurai oleh mikroorganisme tanah. Herbisida ini bekerja dengan menghambat enzim 5-enol-pyruvylshikimate-3-phosphate synthase (EPSPS)

Phosphinotricin (PPT) adalah sebuah analog dari glutamin. PPT menghambat suatu enzim yang terlibat dalam biosintesis asam amino, yaitu gltamine synthase (GS). Dalam tanaman GS terlibat proses asimilasi amonia dari reduksi nitrat, fotorespirasi, atau fiksasi N2 akar. Enzim GS juga berperan regulasi metabolisme N

Sulfonylurea dan imidazolinon (keduanya dari grup berbeda) sama-sama menghambat enzim acetolactat synthase (ALS). Enzim ALS terlibat dalam biosintesis asam amino bercabang, seperti leusin, isoleusin, dan valin

Target Herbisida: Jalur Biosintesis Asam Amino

Glucose

Alanine

Phosphoribosyl

Pyrophosphate

3-phosphoglycerate

Phosphoenolpyruvate

Pyruvate

Histidine

Aminotriazole

Denaturasi

Denaturasi

Denaturasi

Glyphosate

Tryptophan

Tyrosine

Phenylalanine

Glycine

Cysteine

Serine

Leucine

Valine

Isoleusine

Lysine

Threonine

Methionine

Oxaloacetate

Aspartate

Aaparagine

-ketoglutarate

Glutamate

Phosphinocitrin

Arginine

Proline

Glutamine

Sulfonylureas

Imidazolinone

Triazolopyrimidine

RESISTENSI TANAMAN TERHADAP HERBISIDA

Perkembangan teknologi rekombinan DNA memungkinkan manipulasi rekayasa genetika untuk mendapatkan tanaman yang toleran terhadap herbisida

Menurut Oxtoby dan Hughes (1990), metode untu merekayasa resistensi tanaman terhadap herbisida dapat dibedakan ke dalam dua kelompok pendekatan: 1) merubah tingkat sensitivitas dari enzim yang merupakan target herbisida dalam tanaman dan 2) mengintroduksi gen pengkode enzim yang dapat menetralisir (menghilangkan) sifat racun herbisida di dalam tanaman

Herbisida Atrazin. Pendekatan enzim target untuk herbisida Atrazin telah dilakukan dengan memanfaatkan gen mutan yang timbul spontan pada tanaman atau bakteri yang ditemukan di alam

Analisis protein QB dari tanaman mutan resisten menunjukkan adanya substitusi pada satu asam amino dibanding QB tipe awal

Kendala yang dihadapi dalam menciptakan tanaman transgenik menggunakan gen mutan adalah sulitnya mengintroduksi gen ke dalam genom kloroplas

Untuk mengatasi kesulitan teknis tersebut, dalam suatu program, gen mutan psbA dari Amaranthus hybridus dikonversi menjadi gen nukleus dengan menggabungkan sekuens pengkode polipeptidanya dengan sekuens regulasi transkripsi dan sekuens peptida transit gen nukleus

Gen kimera tersebut sewaktu dimasukkan ke dalam genom tanaman tembakau dengan bantuan Agrobacterium menghasilkan protein yang dapat diidentifikasi pada kloroplas tanaman tembakau yang ditransformasi

Tanaman transgenik tersebut toleran terhadap herbisida Atrazin, menunjukkan bahwa protein hasil psbA yang ditranspor berfungsi dalam proses fotosintesis

RESISTENSI TANAMAN TERHADAP HERBISIDA

Herbisida Glyphosate. Resistensi terhadap Glyphosate telah dihasilkan, baik melalui introduksi gen mutan penghasil enzim EPSPS atau dengan ekspresi gen untuk memproduksi enzim tersebut secara berlebihan

Sebuah gen AroA yang menghasilkan enzim EPSPS telah diklonkan dari bakteri Salmonella typhimurium. Tanaman tembakau dan tomat transgenik yang mengandung gen tersebut toleran terhadap Glyphosate

Bahasan di atas adalah pendekatan enzim target

Pendekatan melalui penetralan sifat racun juga sudah banyak dilakukan

Gen penghasil enzim yang mampu menetralisir efek racun herbisida, seperti oksidase, amidase, atau dekarboksilase yang memberikan resistensi herbisida telah diidentifikasi pada beberapa jenis tanaman dan bakteri

Sistem yang telah dipelajari secara intensif adalah konjugasi senyawa xenobiotik dengan glutathione yang dikatalisis oleh enzim multifungsi glutathione-S-transferase (GST)

GST menetralisir Atrazin (gen GSTI) dan Alachlor (gen GSTIII) telah diisolasi dari tanaman jagung

Gen bxn telah diisolasi dari plasmid bakteri tanah Klebsiella ozaenoe

Gen bxn menghasilkan enzim nitrilase yang mengkonversi herbisida bromoxynil (3,5-dibromo-4-hydroxybenzonitrile) yang mengambat fotosintesis menjadi senyawa metabolit tidak aktif (3,5-dibromo-4-hydroxybenzoat)

Klon gen bxn elah diransformasikan ke tembakau dan tomat dan menunjukkan ekspresi toleran terhadap bromoxynil

RESISTENSI TANAMAN TERHADAP HERBISIDA

Gen bar dari Streptomyces hygroscopicus juga telah diklon dan dikarakterisasi

Gen bar tersebut menghasilka enzim phosphinotricin acetyl transferase (PAT) yang mengkonversi phosphinotricin menjadi senyawa terasetilasi yang tidak toksik

Telah ditransformasikan ke tembakau, kentang, dan tomat dan menunjukkan resistensi terhadap herbisida tersebut

Sifat resisten terhadap Atrazin telah pula dilakukan melalui persilangan konvensional dan fusi protoplas terhadap species-species Brassica dan menunjukkan hasil yang baik, namun kultivar yang dihasilkan menunjukkan penurunan produksi hingga 30%

RESISTENSI TANAMAN TERHADAP SERANGGA


Bacillus thuringiensis (bt) adalah bakteri yang menghasilkan suatu protein kristal yang bersifat racun terhadap serangga

Aktivitas bioinsektisida bt tersebut spesifik terhadap species serangga tertentu dan tidak toksik terhadap hewan

Dari lebih 3.000 isolat alam bt yang telah diseleksi oleh Plant Genetic System N.V. Belgium, menunjukkan hampir semua merupakan racun terhadap larva berbagai Lepidoptera dan 5 terhadap larva Coleoptera

Isolat yang dimiliki IIRI Pilipina sebanyak 4.000, telah diidentifikasi sekitar 40 jenis/kombinasi toksin

Gen penghasil toksin pada bt pertama kali diklon tahun 1981

Sejak saat itu lebih dari 13 gen penghasil toksin telah diklon dari berbagai macam isolat bt dan B. sphaericus

Tembakau, tomat, dan kentang transgenik yang mengandung gen toksin bt memperlihatkan resistensi terhadap serangga

Bacillus thuringiensis (Bt)

Nama Gen Cry

Toksik thd

CryIA(a), CryIA(b), CryIA(c)

Lepidoptera

CryIB, CryIC, CryID

Lepidoptera

CryII

Lepidoptera, Diptera

CryIII

Coleoptera

CryIV

Diptera

*bakteri tanah yg sporanya mengandung Crystalline (Cry) protein. Bila serangga memakan-» protein pecah menjadi delta-endotoxin shg keracunan.
* sudah lama digunakan sbg insektisida (Dipel, Thuricide)

Tan. Transgenik:
berdasarkan Karakter, 2000

Karakter Gen

%

Toleran Herbisida

74

Tahan Serangga (Bt)

19

Bt + Tol. Herbisida

»6%

Tahan Virus

«1%

GENERASI I: Proteksi Tanaman

Jagung Transgenik

Tahan Corn Borer

Tahan Herbisida

Tahan Root Worm

Kapas Transgenik ‘BollGard’

Mengandung ‘insecticidal protein’ dr Bacillus thuringiensis, subsp. kurstaki (B.t.k.) yg melindungi kapas dr hama serangga Lepidoptera ttt.

Hama sasaran:

tobacco budworm (Heliothis virescens)

pink bollworm (Pectinophora gossypiella).

cotton bollworm (Helicoverpa zea), scr umum tahan

Transgenik pertama di Indonesia

Teknologi (impor) dr Monsanto


Transgenik Generasi II

Tanaman toleran kekeringan, tanah masam

Tomat tahan simpan, tahan bakteri, tinggi vit. A

Golden Rice, mengandung vit A

Canola dg vit. E dan kandungan asam lemak seimbang

Rumput taman/golf tahan herbisida dan kering

Pisang mengandung vaksin virus

ads.com

BIOTEKNOLOGI

Bioteknologi adalah cabang ilmu yang mempelajari pemanfaatan makhluk hidup (bakteri, fungi, virus, dan lain-lain) maupun produk dari makhluk hidup (enzim, alkohol) dalam proses produksi untuk menghasilkan barang dan jasa.[1] Dewasa ini, perkembangan bioteknologi tidak hanya didasari pada biologi semata, tetapi juga pada ilmu-ilmu terapan dan murni lain, seperti biokimia, komputer, biologi molekular, mikrobiologi, genetika, kimia, matematika, dan lain sebagainya.[1] Dengan kata lain, bioteknologi adalah ilmu terapan yang menggabungkan berbagai cabang ilmu dalam proses produksi barang dan jasa.
Bioteknologi secara sederhana sudah dikenal oleh manusia sejak ribuan tahun yang lalu. Sebagai contoh, di bidang teknologi pangan adalah pembuatan bir, roti, maupun keju yang sudah dikenal sejak abad ke-19, pemuliaan tanaman untuk menghasilkan varietas-varietas baru di bidang pertanian, serta pemuliaan dan reproduksi hewan.[2] Di bidang medis, penerapan bioteknologi di masa lalu dibuktikan antara lain dengan penemuan vaksin, antibiotik, dan insulin walaupun masih dalam jumlah yang terbatas akibat proses fermentasi yang tidak sempurna. Perubahan signifikan terjadi setelah penemuan bioreaktor oleh Louis Pasteur.[1] Dengan alat ini, produksi antibiotik maupun vaksin dapat dilakukan secara massal.
Pada masa ini, bioteknologi berkembang sangat pesat, terutama di negara negara maju. Kemajuan ini ditandai dengan ditemukannya berbagai macam teknologi semisal rekayasa genetika, kultur jaringan, DNA rekombinan, pengembangbiakan sel induk, kloning, dan lain-lain.[3] Teknologi ini memungkinkan kita untuk memperoleh penyembuhan penyakit-penyakit genetik maupun kronis yang belum dapat disembuhkan, seperti kanker ataupun AIDS.[4] Penelitian di bidang pengembangan sel induk juga memungkinkan para penderita stroke ataupun penyakit lain yang mengakibatkan kehilangan atau kerusakan pada jaringan tubuh dapat sembuh seperti sediakala.[4] Di bidang pangan, dengan menggunakan teknologi rekayasa genetika, kultur jaringan dan DNA rekombinan, dapat dihasilkan tanaman dengan sifat dan produk unggul karena mengandung zat gizi yang lebih jika dibandingkan tanaman biasa, serta juga lebih tahan terhadap hama maupun tekanan lingkungan.[5] Penerapan bioteknologi di masa ini juga dapat dijumpai pada pelestarian lingkungan hidup dari polusi. Sebagai contoh, pada penguraian minyak bumi yang tertumpah ke laut oleh bakteri, dan penguraian zat-zat yang bersifat toksik (racun) di sungai atau laut dengan menggunakan bakteri jenis baru.[2]
Kemajuan di bidang bioteknologi tak lepas dari berbagai kontroversi yang melingkupi perkembangan teknologinya. Sebagai contoh, teknologi kloning dan rekayasa genetika terhadap tanaman pangan mendapat kecaman dari bermacam-macam golongan.
Bioteknologi secara umum berarti meningkatkan kualitas suatu organisme melalui aplikasi teknologi. Aplikasi teknologi tersebut dapat memodifikasi fungsi biologis suatu organisme dengan menambahkan gen dari organisme lain atau merekayasa gen pada organisme tersebut.[2]
Perubahan sifat Biologis melalui rekayasa genetika tersebut menyebabkan "lahirnya organisme baru" produk bioteknologi dengan sifat - sifat yang menguntungkan bagi manusia. Produk bioteknologi, antara lain[2]:
  • Jagung resisten hama serangga
  • Kapas resisten hama serangga
  • Pepaya resisten virus
  • Enzim pemacu produksi susu pada sapi
  • Padi mengandung vitamin A
  • Pisang mengandung vaksin hepatitis


ads.com

Jumat, 13 April 2012

Khasanah Plasma Nutfah Nabati Indonesia

A. Pengertian Plasma Nutfah
            Plasma nutfah adalah substansi yang terdapat dalam setiap makhluk hidup dan merupakan sumber sifat keturunan yang dapat dimanfaatkan dan dikembangkan atau ditarik untuk menciptakan jenis unggul atau kultivar baru. Termasuk dalam kelompok ini adalah semua kultivar unggul masa kini atau masa lampau, kultivar primitif, jenis yang sudah dimanfaatkan tapi belum dibudidayakan, jenis liar kerabat jenis budidaya dan jenis-jenis budidaya.
B. Luas Area Dan Keragaman Plasma Nutfah
            Indonesia termasuk wilayah propinsi botani Malaysia yang keseluruhannya meliputi semenanjung Malya, kepulauan Philipina, Indonesia dan Papua Nugini tanpa pulau-pulau Colomon, luasnya mencapai 3.000.000 km2, meliputi sepertujuh panjang katulistiwa, kebanyakan daerahnya lembab. Secara biologi daerah propinsi ini termasuk kaya karena diduga dihuni oleh 35.000 jenis tumbuhan atau sekitar 10% dari seluruh jenis tumbuhan yang hidup di dunia saat sekarang. Kekayaan di daerah ini dapat dibuktikan dengan membandingkan antara pulau Jawa dan Inggris raya yang luasnya 4 x Pulau Jawa hanya dihui oleh 1.500 tumbuhan.
            Di Indonesia tempat tumbuh plasma nutfah nabati sebagian besar merupakan hutan tropik, sehingga kaya akan suku dari tumbuh-tumbuhan yang khas tropik seperti Dipterocarpaceae, Sapotaceae, Ebenaceae, Myristicaceae, Meliaceae, Zingiberaceae, Palmae, Moraceae, Rhizopphoraceae, Padananceae dan lain-lain. Di daerah-daerah pegunungan terdapat suku-suku yang mirip suku yang ada pada belahan bumi utara seperti Fagaceae, Rosaceae, Lauraceae, Theaceae dan lain-lain.
Di kawasan Indonesia juga dapat tumbuh dengan subur jenis-jenis tumbuhan, epifit, bambu dan benalu, Rafflesia, cendana, ficus dan lain-lain.
            Dasar pengetahuan botani atau untuk dapat dikenal secara botani, daerah seluas 100 km2 diperlukan koleksi herbarium sebanyak 100 nomor.
Di Propinsi Malaesia sudah terkumpul 1.000.000 nomor koleksi. Ini berarti bahwa untuk dapat dikatakan kekayaan yang ada dapat  dikenal secara sempurna masih diperlukan 2.000.000 nomor koleksi lagi, dan koleksi ini kebanyakan bersifat koleksi botani, maksudnya untuk tanaman-tanaman budidaya dan kultivar-kultivarnya masih belum ditangani.
C. Bentuk Wadah Dan Macam Plasma Nutfah
            Wadah plasma nutfah secara alami berupa ekosistem, dari jenis yang liar dapat berupa hutan, savana, semak, padang rumput, semi padang pasir dan sebagainya.
            Macam plasma nutfah, selain berupa jenis tumbuhan liar juga varietas primitif, varietas pembawa sumber sifat yang khusus, varietas unggul yang sudah kuno dan varietas unggul masa kini.
1. Jenis liar atas dasar sejarah pembudidayaan dan penggunaan potensinya dapat digolong-kan menjadi tiga kelompok yaitu :
- Jenis-jenis yang mungkin mempunyai nilai ekonomi, tetapi sama sekali belum mem-budidayakan atau dipetik hasilnya.
- Jenis-jenis yang sudah dipetik dan dimanfaatkan hasilnya tetapi belum atau tidak di-budidayakan.
- Jenis-jenis yang tidak dipetik hasilnya, akan tetapi setelah mengalami atau melalui hi-bridisasi baru kemudian dibudidayakan dan dimanfaatkan.
2. Varietas primitif
            Semua jenis yang dibudidayakan secara langsung atau tidak berasal dari liar. Varietas primitif adalah kultivar yang pembudidayaannya masih sederhana, belum mengalami pemuliaan. Tumbuhannya yang termasuk kelompok ini biasanya di daerah tumbuhnya mempunyai daya daptasi yang lebih baik, lebih tahan terhadap tekanan lingkungan yang bersifat fisik maupun biologi.
Hal ini dimungkinkan karena sudah ada seleksi gen secara alamiah yang tahan terhadap dingin, panas, hama ataupun penyakit di daerah tumbuh.
3. Varietas sumber sifat yang khusus
            Kultivar yang mempunyai kelebihan dalam sifat-sifat tertentu, misalnya kepekaannya terhadap pemupukan. Sinar ketahanan terhadap hama atau penyakit tertentu atau sifat khusus yang lain seperti produksi.
4. Varietas unggul
            Karena kemajuan di bidang pemuliaan, varietas unggul dapat diciptakan dengan merakit sifat-sifat yang baik dari beberapa sumber plasma nutfah.
Semakin besar sifat keanekaragaman yang dimilikinya, akan semakin bebas pemulia untuk merakit sifat-sifat yang  baik. Dengan silih bergantinya zaman, varietas unggul tidak dapat langgeng bertahan dipakai oleh petani. Memang pada saat tertentu atau pada kondisi yang memadai varietas unggul mampu mengatasi atau melebihi hasil varietas lain, akan tetapi pada kondisi yang lain untuk lingkungan yang kurang menguntungkan misalnya munculnya kembali penyakit atau hama di daerah penanamannya dapat memukul parah bahkan mengakibatkan fatal.
Hal ini dapat disadari sebagai akibat kehogenan sifat gennya yang tinggi, varietas unggul peka terhadap lingkungan yang kurang menguntungkan.
Dengan pergantian varietas unggul-unggul dari masa ke masa, maka dikenal varietas unggul masa kini dan varietas unggul masa lampau atau yang sudah kuno.
D. Permasalahan Kelestarian Plasma Nutfah Nabati
            Sebagai salah satu sumber daya alam, pengelolaan pemanfaatan plasma nutfah sekarang ini dirasakan kurang sempurna yaitu banyak mengalami erosi yang menyebabkan berkurangnya dan hilangnya jenis-jenis tertentu.
            Banyak faktor yang dapat menyebabkan terjadinya erosi plasma nutfah nabati antara lain adalah :
1. Timbulnya peledakan penduduk yang sangat besar, yang menyebabkan perlunya perluas-an daerah permukiman di daerah-daerah pertanian yang mengakibatkan terjadinya penggusuran tempat tumbuh plasma nutfah.
2. Terjadinya eksploitasi hutan yang kebanyakan dilakukan dengan tidak memperhatikan kelestarian plasma nutfah yang dikandungnya, sehingga banyak jenis-jenis pohon yang mengalami erosi genetika seperti kayu olin, cendana, sawo, kecik. Di samping itu eksploitasi hutan juga berakibat merusak habitat hewan dan tumbuhan lain seperti jenis-jenis anggrek, paku-pakuan, rotan dan tanaman perdu yang lain.
3. Timbulnya tehnologi modern yang sering mengakibatkan terdesaknya bahan alam oleh bahan sintesis, sehingga membahayakan kelestarian plasma nutfah tertentu seperti tarum dan golongan serat-seratan.
4. Penggunaan tumbuhan untuk keperluan industri yang sering dilakukan secara besar-besaran tanpa memperhatikan peremajaan, misalnya golongan temu-temuan, kedawung, rotan, tengkawan.
            Semua kegiatan di atas adalah merupakan beberapa contoh yang dapat menyebabkan terjadinya erosi plasma nutfah nabati, sehingga apabila proses tersebut terus berlangsung tanpa adanya usaha untuk mengatasinya, akan kehilangan beberapa jeis-jenis tertentu yang berarti juga kehilangan sebagian sumbernya alam.
            Sebagai akibat terjadinya erosi genetika mengakibatkan timbulnya kelangkaan pada jenis-jenis tertentu, untuk mengetahui tingkat kelangkaan dari suatu jenis plasma nutfah nabati, dikenal ada 5 macam katagori yaitu :
1. Extinct (punah) adalah sebutan yang diberikan pada tumbuhan yang telah musnah atau hilang sama sekali dari permukiman bumi.
2. Endangeret (genting) adalah sebutan untuk jenis yang sudah terancam kepunahan dan tidak akan dapat bertahan tanpa perlindungan yang ketat untuk menyelamatkan kelangsungan hidupnya. Contoh : Rafflesia arnoldii dan purwoceng (Pimpinella pruatjan).
3. Vulnerable (rawan) katagori ini untuk jenis yang tidak segera terancam kepunahan tetapi terdapa dalam jumlah yang sedikit dan eksploitasinya terus berjalan sehingga perlu dilindungi contohnya adalah : cendana (Satalum album) kayubesi (Eusideroxylon ewageri) dan ki koneng (Arcangelisis flava).
4. Rare (jarang) sebutan untuk jenis yang populasinya besar tetapi terbesar secara lokal atau daerah penyebarannya luas tapi tidak sering dijumpai, serta mengalami erosi yang berat. Contohnya : sawo kecik (Munilkara kauki), kedawung (Parkia roxburghii) dan pulai pandak (Rauvolfia serpentina).
5. Indeterminate (terkikis) sebutan untuk jenis yang jelas mengalami proses pelangkaan tetapi informasi keadaan sebenarnya belum mencukupi, sebagian besar jenis-jenis plasma nutfah nabati yang langka termasuk katagori ini.
E. Metode Pelestarian Plasma Nutfah Nabati
            Dalam penggunan sumber daya genetika, eksplorasi dan pelestarian adalah merupa-kan kegiatan pokok yang dwitunggal di dalam penyelamatan plasma nutfah. Eksplorasi menyelamatkan sumber daya yang ada di lapangan, pelestarian menyelamatkan koleksi yang baru dan yang sudah ada. Apabila dalam eksplorasi diperlukan mekanisme kegiatan yang terarah di lapangan yang seluas mungkin, sedangkan yang diperlukan dalam pelestarian adalah keefektifan organisasinya. Dalam kegiatan mengadakan eksplorasi, pengumpulan, evaluasi dan pelestarian plasma nutfah tersebut dimaksudkan untuk mencadangkan setiap nama koleksi yang juga dapat digunakan dalam mencari dan menciptakan bibit unggul baru melalui seleksi atau persilangan-pesilangan.
            Strategi pelestaria plasma nutfah nabati dapat berciri :
1. Genotin tunggal atau populasi.
2. Tumbuhan hidup, biji, tepung sari, biakan jaringan atau meristem.
3. Satu, beberapa atau banyak jenis ekonomi.
4. Bersifat nasional, regional atau internasional.
5. Dalam bentuk koleksi dasar (base collection) atau koleksi aktif.
            Dalam pelaksanaan strategi pelestarian biasanya timbul permasalahan-permasalahan sebagai akibat adanya faktor-faktor pembatas antara lain meliputi :
1. Masalah biasa yang menyangkut keuangan.
2. Hama dan penyakit.
3. Kemungkinan akan kehilangan kesempurnaan genetik.
4. Daur peremajaan.
5. Keterbatasan tenaga dan tehnik.
Sehingga untuk mencapai keberhasilan dalam pelestarian, dalam pelaksanaannya harus selalu diikuti dengan pemecahan masalah-masalah yang timbul.
            Metode pelestarian plasma nutfah nabati ada 2 bentuk yaitu yang disebut pelestarian IN SITU dan EX SITU.
1. Pelestarian in situ
            Cara pelestarian ini adalah melestarikan plasma nutfah di dalam komunitasnya, di dalam biotanya. Cara pelestarian ini pada umumnya cocok untuk jenis-jenis liar, sebab untuk pelestarian jenis liar sering timbul adanya kesukaran-kesukaran yang disebabkan :
- Faktor adaptasi terhadap daerah dan iklim yang baru.
- Faktor hama dan penyakit.
- Ukuran perawakan dan daur hidupnya.
Pelestarian secara in situ yang umum dilakukan adalah dengan cagar alam atau daerah lindung.
Pengawasan plasma nutfah di daerah lindung harus dilakukan secara teratur dan berkesinambungan.
Pelestarian secara in situ dilaksanakan dalam hutan, semak, savana, stepa atau biota yang lain, jadi cara pelestarian ini dalam bentuk koleksi tumbuhan hidup. Sehubungan dengan tujuan pelestarian plasma nutfah yang ada, maka pengelolaan hutan seharusnya : keseimbangan ekosistem dijaga sestabil mungkin guna melindungi plasma nutfah yang belum diusahakan.
2. Pelestaria ex situ
            Pelaksanaan cara pelestarian ini adalah dengan mengeluarkan plasma nutfah dari wadahnya, ekosistemnya atau biotanya, dan cara ini akan dapat dianggap berhasil baik dan murah apabila yang dilestarikan dapat ditekan sampai tingkat yang minimal.
Ada beberapa bentuk dalam pelestarian secara ex situ :
- Koleksi tumbuhan hidup
Cara ini dapat dilakukan pada kebun raya, Arboreta, kebun buah-buahan, kebun tanaman luar (introduksi), stasiun/kebun pemuliaan dan kebun-kebun yang lain.
- Bentuk penyimpanan biji
Pelestarian dalam bentuk penyimpanan biji harus diperhatikan jenis biji yang akan disimpan, sebab atas dasar sifatnya ada 2 kelompok jenis biji yaitu :
a. Jenis yang orthodog yaitu jenis biji yang bereaksi positif terhadap pengeringan dan pendinginan atau juga disebut mempunyai kepekaan positif terhadap suhu rendah, pelaksanaannya adalah sebagai berikut :
- penurunan kadar air sampai 5%
- suhu penyimpanan 10C, atau lebih baik 0sampai 20C
- disimpan di tempat yang gelap, tidak terjadi pertukaran uap air, gas dan kelembaban udara kurang dari 70%, tempat penyimpanan dapat berupa kaleng, gelas atau kantong aluminium.
- tekanan O2 dijaga serendah mungkin dan CO2 setinggi mungkin
b. Jenis yang rekalasitranya itu jenis biji yang bereaksi negatif terhadap pengeringan dan mungkin juga dengan pendinginan. Jenis ini banyak terdapat pada pertumbuhan tropis yang tumbuh di hutan atau daerah basah. Contoh : Cola, Artocarpus, Coffea, Theobroma, Havea dan macam-macam palmae, cara penyimpanan setiap jenis mempunyai persyaratan yang berbeda dengan jenis yang lain. Sehingga perlu penelitian yang lebih intensif.
- Bentuk penyimpanan tepung sari
Seperti penyimpanan kebanyakan biji, dalam penyimpanan tepung sari, daya hidupnya akan lebih panjang apabila diperlukan penurunan suhu penyimpanan, kadar air dan tekanan O. Yang masih sulit dijumpai adalah untuk penyimpanan dari jenis Gramineae, Alismataceae dan Cyperaceae.
- Bentuk penyimpanan persediaan meristem dan jaringan
Dalam bentuk penyimpanan ini daya berkembangnya ditekan sekecil mungkin atau dihilangkan sama sekali tetapi daya hidupnya dipertahankan sebaik mungkin.
Keuntungan dari cara ini adalah :
- Ruang yang diperlukan relatif sempit.
- Pemeliharaan murah dan sederhana.
- Tidak ada erodi genetika.
- Potensi perbanyakan tinggi.
- Yang bebas dari pathogen dapat dipelihara dan diperbanyak.
Kesulitannya adalah :
- Tidak semua jenis dapat dilakukan dengan cara ini.
- Regenerasi tumbuhan dari jaringan tidak selalu berhasil.
- Potensi perkembangan bentuk dapat hilang pada jangka penyimpanan tertentu.
Penyimpanan pada suhu rendah dimungkinkan lebih berhasil (suhu nitrogen cair -196C). Pelestarian plasma nutfah yang tidak dalam bentuk tanaman hidup, akan selalu disertai satu contoh herbarium yang sering disebut voecher atau herbarium acuan. Herbarium tersebut diperlukan sebagai jalan untuk mendeterminasi contoh yang dikumpulkan untuk keperluan penelitian
VIII. AGROEKOSISTEM
            Manusia telah mengubah ekosistem alam secara luas sejak mulai mengenal pemukiman. Mereka membersihkan hutan dan lahan rumput untuk mengusahakan tanaman bahan makanan dan bahan makanan ternak untuk dirinya dan ternaknya melalui berbagai pengalaman. Mereka mengembangkan pertanian dengan membersihkan tanah, membajaknya, menanam tanaman musiman dan memberikan unsur-unsur yang diperlukan, seperti pupuk dan air. Setelah menghasilkan kemudian dipanen. Sejak menebar benih sampai panen tanaman pertanian sangat tergantung alam, gangguan iklim, hama dan penyakit.
            Agroekosistem (ekosistem pertanian) ditandai oleh komunitas yang monospesifik dengan kumpulan beberapa gulma. Ekosistem pertanian sangat peka akan kekeringan, frost, hama/penyakit sedangkan pada ekosistem alam dengan komunitas yang kompleks dan banyak spesies mempunyai kemampuan untuk bertahan terhadap gangguan iklim dan makhluk perusak. Dalam agroekosistem, tanaman dipanen dan diambil dari lapangan untuk konsumsi manusia/ternak sehingga tanah pertanian selalu kehilangan garam-garam dan kandungan unsur-unsur antara lain N, P, K, dan lain-lain. Untuk memelihara agar keadaan produktivitas tetap tinggi kita menambah pupuk pada tanah pertanian itu. Secara fungsional agroekosistem dicirikan dengan tingginya lapis transfer enersi dan nutrisi terutama di grazing food chain dengan demikian hemeostasis kecil.
            Kesederhanaan dalam struktur dan fungsi agroekosistem dan pemeliharaannya untuk mendapatkan hasil yang maksimum, maka menjadikannya mudah goyah dan peka akan tekanan lingkungan seperti kekeringan, frost, meledaknya hama dan penyakit dan sebagainya.
            Peningkatan produksi pertanian untuk memenuhi kebutuhan penduduk yang semakin meningkat akhir-akhir ini dihasilkan satu tehnologi antara lain : mekanisasi, varietas baru, cara pengendalian pengganggu, pemupukan, irigasi dan perluasan tanah dengan membuka hutan dan padang rumput.
Semua aktivitas pertanian itu menyebabkan implikasi ekologi dalam ekosistem dan mempengaruhi struktur dan fungsi biosfere.
            Peningkatan hasil tanaman dimungkinkan melalui cara-cara genetika tanaman dan pengelolaan lingkungan dengan menyertakan peningkatan masukan materi dan enersi dalam agroekosistem. Varietas baru suatu tanaman dikembangkan melalui program persilangan dan saat akan datang dapat diharapkan memperoleh varietas baru melalui rekayasa genetika yang makin baik. Varietas baru mempunyai syarat-syarat kebutuhan lingkungan dan ini penting untuk diketahui ekologinya sebelum disebarkan ke masyarakat dengan skala luas.
            Pengelolaan lingkungan menimbulkan beberapa persoalan pada erosi tanah, pergantian iklim, pola drainase dan pergantian dalam komponen biotik pada ekosistem.
            Pada tahun 1977 State of World Environment Report (UNEP), memperingatkan abhwa, tanah yang dapat ditanami terbatas, hanya 11% permukaan bumi dapat diusahakan untuk pertanian. Secara total 1.240 juta ha untuk populasi 4.000 juta (rata-rata 0,31 ha/orang). Area ini pada tahun 2.000 akan tereduksi sampai hanya tinggal 940 juta ha dengan populasi penduduk dunia 6.250 juta.
Sehingga perbandingan lahan/orang tinggal 0,15 ha saja. Ini merupakan suatu peringatan dan memerlukan perhatian segera.
            Sebab-sebab semakin kecilnya tanah yang dapat ditanami antara lain :
1. Pemotongan vegetasi/penggundulan sehingga tanah terbuka sehingga mudah tererosi air dan angin.
2. Mekanisasi pertanian dan penggunaan pupuk organik yang menggemburkan tanah dan membuatnya peka terhadap erosi.
3. Irigasi tanpa diimbangi dengan drainase yang mengakibatkan terbentuknya lapisan kedap air dan tanah menjadi kekurangan air. Lebih dari 300.000 ha tanah yang dapat ditanami dirugikan karena salinisasi dan kebanjiran setiap tahun.
4. Pengerjaan tanah yang tidak memenuhi syarat dapat menyebabkan erosi.
5. Urbanisasi.
Hal yang disebutkan di atas merupakan situasi yang dibuat oleh manusia dan dia sendiri sebenarnya dapat mengendalikannya/mencegahnya melalui pengelolaan agroekosistem berdasarkan prinsip-prinsip ekologi. Studi ekologi ekosistem tanah pertanian disertai dengan pengetahuan autekologi tanaman dan gulma dengan dilengkapi watak pertumbuhannya dan sifat kompetitifnya. Hubungan tanaman-gulma pada tingkat intra dan antar spesies memerlukan informasi, yang berguna untuk praktek agronomi kita.
Hubungan tanah-tanaman merupakan aspek lain yang memerlukan data untuk pengelolaan subsistem tanah dalam maksud memulihkan tingkat kesuburan tanah yang maksimum. Pengetahuan pergantian komponen fisik, kimia dan biologi tanah pertanian di bawah pola tanam yang berbeda sangat penting untuk pengelolaan ekosistem. Penggunaan pupuk, pestisida dan herbisida berpengaruh terhadap ekosistem.
N dengan skala luas berpengaruh terhadap lapisan Ozon di Stratosfer. Kebanyakan pestisida/herbisida merubah sifat fisik, kimia dan biologi subsistem tanah.
Beberapa bahan kimia mengalir ke kolam dan sungai dengan demikian mempengaruhi flora dan fauna ekosistem air tawar. Revolusi hijau dalam 1970 membawa pergantian pandangan pertanian kita. Siapnya tanah yang dapat diairi dan air pengairan menjadi tidak cukup dan sekarang hampir terjadi keduanya di daerah yang sama. Kesuburan jangka panjang tanah pertanian yang stabil (mantap) dibahayakan tidak hanya oleh pengetahuan yang sedikit tentang efek tekanan kimia, ekologi dan mekanisasi dalam intensifikasi tetapi juga tekanan populasi langsung antara lain overgrazing, penggundulan, penanaman di daerah dengan kemiringan yang berbahaya, urbanisasi tanah pertanian utama dan pengaruh sampingan langsung dan tidak langsung.
            Laporan UNEP (1977) tentang gambaran keadaan lingkungan kurangnya makanan terutama protein sekarang terjadi dengan implikasi yang mencemaskan, dua hal yang kelaparan dan untuk kestabilan politik dunia. Situasi hari ini dengan pola distribusi penduduk seperti itu yaitu perkembangan kota dengan lebih banyak manusia dan kurang memproduksi makanan memaksa mereka impor bahan makanan dari negara terbelakang.
Struktur Agroekosistem
Struktur biotik
            Kebanyakan tanaman merupakan tanaman semusim, baik anual maupun bianual. Tanaman dipelihara dengan populasi murni, biarpun beberapa gulma tumbuh bersama-sama tanaman.
Benih gulma, selalu ada di lapangan, tumbuh pada kondisi yang biarpun kadang-kadang kurang menguntungkan. Kebanyakan gulma, disebarkan dalam bentuk biji pada waktu penebaran dan juga melalui air irigasi dan binatang perantara. Tanaman dan gulma merupakan produsen dan konsumennya terutama herbivora, terdiri atas beberapa spesies serangga, burung dan ammalia kecil. Populasi dekomposer (pembusuk) kebanyakan bangsa fungi, bakteri dan nematoda dan sebagainya. Pengetahuan mengenai karakteristik fenologi dan fitososiologi (kepadatan, frekuensi dan pertumbuhan) ekosistem tanaman pada interval 15 hari akan menggambarkan dinamika hubungan tanaman dengan gulma - serangga - burung. Studi mengenai LAI, struktur khlorofil (jumlah khlorofil terdistribusi pada daun, cabang dan batang) yang menyertai profil biomas dan pola penyimpanan enersi pada produsen primer memberikan informasi mengenai aktivitasnya.
Produsen primer
            Untuk mengendalikan gulma terbaik antara lain adalah dengan mengatur daur hidup bersama dengan tanaman. Penelitian di lapangan menunjukkan bahwa ada indikasi bahwa gulma sangat bervariasi dari lapangan ke lapangan tergantung tipe tanaman dan musim pertumbuhan. Sifat fisik dan kimia tanah, faktor iklim mikro di dekat permukaan tanah, dominasi benih gulma memungkinkan adanya variasi kualitatif dan kuantitatif dalam  flora gulma di lapangan pertanian.
Gulma berkompetisi dengan tanaman pokok untuk faktor pertumbuhannya dan mempengaruhi pertumbuhan tanaman dan hasil. Biomas merupakan yang baik untuk struktur komunitas. Tidak seperti komunitas alam, biomas tanaman tetap bertambah dari permulaan, stadium pertumbuhan vegetatif sampai panen.
Nilai biomas tanaman yang diperoleh waktu panen memperlihatkan variasi yang lebar di antara tanaman yang berbeda di pertanaman monokultur. Kecuali ubi-ubian, perbandingan yang lebih besar penimbunan bahan kering terjadi di batang. Akar menempati proporsi yang kecil dari keseluruhan biomas (15-20%). Dengan demikian perbandingan akar dan batang kecil (0,1-0,3) di tanaman pertanian.
Perbandingan itu bervariasi antara 0,8 - 3,1 di padang rumput yang didominasi oleh rumput tahunan dan legum memperlihatkan akumulasi biomas bagian dalam tanah lebih besar.
            Luas daun tanaman merupakan pengukuran terbaik untuk  besarnya fotosyntesis dan pengukuran luas daun yang lebih praktis untuk lapangan pertanian dengan hasil ditunjukkan per unit luas lahan, ialah luas daun per unit luas lahan (LAI). Kominitas tanaman pertanian mempunyai nilai rata-rata antara 6 - 13 (hutan) dan 3 - 15 (rumput-rumputan). Dalam tanaman semusim LAI terus naik dengan bertambahnya umur dan menuju puncak pada pembungaan yang kemudian turun. Komunitas alam tidak seperti itu.
Pada serealia LAI tidak menghitung asimilasi total yang terdapat di batang dan bulir yang memiliki khlorofil memperlihatkan secara nyata efisiensi fotosintetik tanaman. LAI ada korelasi positif dengan produktivitas dalam beberapa contoh produksi maksimum diperoleh bila LAI di sekitar 4.
Perhitungan lebih jauh dalam LAI tidak membawa efek positif pada produksi bersih karena harus mengimbangi kehilangan respirasi. Sudut daun dan posisinya berinteraksi dengan LAI dalam peranan penetrasi cahaya ke dalam kanopi. Daun yang tegak dengan sudut yang kecil/tajam semacam rumput-rumputan menyebabkan distribusi cahaya yang lebih efisien dalam kanopi daripada yang horizontal.
Pola daun yang spesifik menentukan produksi komunitas tanaman pertanian. Dari beberapa penelitian memperlihatkan bahwa arah barisan (Utara, Selatan, Barat, Timur) dapat memberikan pengaruh pada hasil hubungannya dengan penetrasi cahaya.
            Khlorofil di tanaman hijau menangkap energi cahaya untuk proses fotosintesis. Kandungan khlorofil ada hubungannya dengan produksi bahan kering, dan digunakan sebagai suatu indeks produksi potensial produksi populasi tanaman/komunitas.
Daftar 4. Kandungan khlorofil pada ekosistem tanaman yang berbeda (gr/m2)
Tanaman
Khlorofil
Tanaman pertanian yang rapat
Jagung
Gandum
Padi
0,30 - 0,50
2,66
7,11 - 10,75
2,05 - 4,25

Sumber : K.C. Misra (1980)
            Dalam hubungannya dengan umur memperlihatkan peningkatan sampai dengan pembungaan kemudian turun karena ada senescene dan sheding daun bawah.
            Stratifikasi distribusi khlorofil pada padi dan gandum menunjukkan bahwa kandung-an khlorofil terkecil di dekat permukaan tanah dan secara berangsur-angsur naik dengan semakin jauh dari permukaan tanah sampai calon bulir, tetapi setelah pembungaan jumlah khlorofil di semua strata cenderung menurun. Akumulasi khlorofil lebih besar dalam strata yang lebih atas kemungkinan hubungannya dengan penggunaan yang lebih efisien dalam enersi cahaya.
            Kandungan enersi per unit berat jaringan dan jumlahnya dalam phytomass menunjukkan struktur subsistem produsen dalam ekosistem.
Konsentrasi kalori di beberapa tanaman sebagai berikut :
Daftar 5. Kandungan enersi pada beberapa tanaman (K cal/gr berat kering)
Tanaman
Daun
Cabang
Buah
Akar
Jagung (India)
Jagung (Jerman)
Heliantus annus
Triticum aestivum
Phaseolus aureus
Oryza sativa
3,445
4,045
3,404
3,672
3,870
4,126
3,145
4,155
4,014
4,074
0,073
3,684
4,025
4,291
5,014
4,109
4,498
4,005
2,805
3,192
4,611
4,024
4,267
3,578

Sumber : K.C. Misra (1980)
            Umur tanaman dan komposisi kimia membawa pengaruh terhadap variasi kandungan enersi. Di beberapa varietas pada kandungan enersi yang tinggi terjadi selama pertumbuhan vegetatif dari awal.
Pada gandum dan rumput memperlihatkan konsentrasi kalori berhubungan dengan berubahnya perbandingan lemak, karbohidrat dan protein dalam tanaman.
Lemak dan minyak merupakan organ yang diperkaya enersi. Pola akumulasi enersi di beberapa varietas padi terjadi selama fase pertumbuhan vegetatif.
Pada permulaan menunjukkan 41 - 53% dari titik enersi diakumulasi di helaian daun dan 16 - 23% di akar. Akumulasi enersi di batang secara bertahap meningkat sesuai dengan meningkatnya berat tanaman. Tingkat kemasakan 85 - 90%, total enersi diperlihatkan oleh biomas dalam bentuk biji dan daun, dan sisanya 10 - 15% berupa batang dan akar.
Konsumen
            Karena produsen yang homogen maka hanya beberapa binatang yang sesuai saja mengambil bagian dari ekosistem tersebut. Rantai makanan sangat sederhana dengan 2 - 3 tingkatan trofik. Lebih-lebih dengan beberapa aktivitas pengolahan tanah, irigasi, penyiangan dan sebagainya yang mempengaruhi binatang dalam tanah dan kadang-kadang hal ini pengaruhnya sangat tegas sehingga tercipta kondisi baru. Komunitas tanaman hanya dapat dijadikan tempat tinggal binatang kecil yang hanya datang secara temporer.
Pengurai
            Karena praktek-praktek pemeliharaan antara lain pemupukan, penggunaan pestisida serta kecilnya kandungan bahan organik maka mempersempit aktivitas dekomposer/pengurai dalam ekosistem pertanian.
Abiotik
            Praktek bercocok tanam yang berbeda dapat menyebabkan komposisi fisik dan kimiawi tanah yang berbeda. Pemupukan kimia, irigasi dan pola drainase menyebabkan perbedaan kualitas tanah.
Ciri-ciri tanah pertanian :
- mudah tererosi
- lapisan kesuburan 30 cm
- akumulasi garam di lapisan bawah (pelindian)
- miskin bahan organik
            Untuk mengevaluasi struktur abiotik agroekosistem kita dapat mengestimasi jumlah nutrien (N, P, K, dan sebagainya) yang ada dalam biomas dan tanah pada setiap waktu dengan demikian dapat untuk mempertimbangkan pemupukan dan irigasi yang tepat.
Fungsi Dalam Agroekosistem
Produktivitas primer
            Dari tinjauan produktivitas organik dengan masukan enersi, agroekosistem dunia saat ini menghasilkan 10 milyar ton bahan kering/tahun.
Cahaya matahari yang masuk ke kanopi tanaman digunakan dalam proses fotosintesis yang menghasilkan kekuatan dalam produktivitas organik. Penelitian dari beberapa disiplin menghasilkan suatu kesimpulan bahwa sekarang ada 3 mekanisme fotosintesis ialah siklus Kelvin, C4 - asam dekarboksilat dan metabolisme asam grasulacean. Sejumlah tanaman penting (jagung, gula, shorgum dan sebagainya) mempunyai jalur C4. Produktivitas bersih tanaman C4 lebih tinggi dari tanaman siklus Kelvin. Tanaman selama puncak musim pertumbuhan mengkonversi 6 - 8% total enersi sinar matahari ke bahan organik dalam produksi kotor. Produksi bersih rata-rata ½ produksi kotor itupun hanya 50% yang dapat untuk heterotrop (hewan dan manusia).
Efisiensi konversi enersi berbeda karena :
- beda varietas
- musim pertumbuhan
- kondisi pertumbuhan/pertanaman
Daftar 6. Hubungan antara enersi solar dan produksi bersih/kotor (K cal/cm2/hr)
Tanaman
Radiasi Solar
Prod. Bersih
Prod. Kotor
Author’s
Gula (Hawai)
Jagung (Israel)
Gula bit (Ingg.)
Gandum (India)
Padi (India)
4.000
6.000
2.650
1.567
2.904
190
190
144
43
60
306
405
202
55
-
Montieth, ‘65
Montieth, ‘65
Montieth, ‘65
Dwivedi, ‘70
Singh, MK, ‘74

Sumber : K.C. Misra (1980)
Daftar 7. Produksi primer bersih (g/m2/hr) dan efisiensi konsentrasi enersi (%) tanaman pertanian
Tanaman
PPN lamanya tanam
Semusim
eke %
Author’s
Gandum (diairi dan dipupuk)
9,96-10,65
3,90-4,08
1,99-2,29
Misra dan Pan-dey, ‘72
Pearl millet (tak diairi dan dipupuk)
21,12
6,94
-
Misra dan Pan-dey, ‘72
Jagung (diairi dan di-pupuk)
4,50-8,36
1,32-2,64
0,98-1,48
Misra dan Pan-dey, ‘72
Padi (diairi dan di-pupuk)
14,82-15,65
5,14-5,49
2,58-2,91
Nayar, ‘72
Padi (tak diairi dan tak dipupuk)
7,74-13,69
2,69-3,90
1,50-3,90
Singh, ‘74

Sumber : K.C. Misra (1980)
            Di samping cahaya dan suhu, sebagai pengendali produksi bersih dalam agro-ekosistem adalah kelembaban tanah, nutrisi dan kompetisi baik intra/antar spesies. Untuk lebih mendalami variasi produksi bahan kering kita perlu mengetahui beda varietas dan kondisi lingkungan dengan analisis pertumbuhan (growth analysis) yaitu dengan mendeterminasi :
1. Laju asimilasi per unit luas daun (NAR)
2. Laju produksi bahan kering per unit berat bagian tanaman (RGR)
3. Luas daun per unit luas lahan (LAI)
(Leopold, 1975/1980)
Hubungan antara RGR, NAR dan LAI serta produksi primer bersih (NPP) seperti grafik di bawah ini.
Gambar 17. Hubungan antara RGR, NAR dan LAI serta produksi primer bersih (NPP)
(Sumber : K.C. Misra, 1980)
            RGR menentukan produktivitas, nilai tertinggi pada fase vegetatif awal untuk menuju NAR yang lebih besar. Tetapi NAR turun karena adanya peneduhan daun pada puncak periode pertumbuhan vegetatif, RGR menunjukkan menurun tajam. Penurunan RGR diimbangi dengan peningkatan LAI dan NPP. Pada waktu tanaman mendekati masak, ukuran relatif akan turun dan juga efisiensi asimilasinya karena adanya sheding dan senescence yang memungkinkan RGR turun dengan tajam juga NPP.
Pada tanaman semusim yang merupakan dasar tanaman pertanian menunjukkan produktivitas/kesatuan luas relatif rendah karena tanaman semusim hanya produktif untuk masa kurang dari 6 bulan. Penanaman ganda dengan menggunakan 2 - 3 tanaman yang produksinya sepanjang tahun dapat mendekati produktivitas kotor komunitas alam yang terbaik.
            Suatu perbandingan produktivitas primer bersih musiman komunitas terestrial memperlihatkan sedikit lebih tinggi untuk tanah yang diusahakan. Lebih tingginya produktivitas bersih di agroekosistem karena adanya tambahan masukan enersi, nutrisi, perbaikan genetika tanaman pertanian dan tindakan pengendalian serangga.
Daftar 8. Produksi primer bersih musiman (t/ha) komunitas terestrial
Komunitas
Produksi
Author’s
hutan musim tropik
Padang rumput
Jagung/Gandum
15,50
7,44-23,13
24,45
Misra, 1972
Singh, J.S., 1967
Misra dan Pandey, ‘72

Sumber : K.C. Misra (1980)
Aliran enersi
            Tanah pertanian merupakan ekosistem tersubsidi yang diperlukan untuk membuat kondisi optimum yang diinginkan dengan tujuan efisiensi produsen pada tingkat batas maksimum. Subsidi itu tentu saja sangat diperlukan, lebih-lebih dengan waktu singkat harus menghasilkan, seperti pada kebanyakan tanaman semusim antara 60 - 90 hari saja subsistem produsen mencapai kemasakan dan efisiensi fotosintesis menurun karena umur.
Setelah panen kira-kira 85 - 905 enersi terakumulasi dalam bagian atas tanah yang kemudian masuk ke grazing food chain yang sederhana terutama meliputi manusia dan ternak.
            Menurut Singh (1974) pada padi produksi bersih 5 - 60% berbentuk jerami dan biji. Dalam agrosistem daerah sedang (temperate) lebih 50% enersi yang dipanen, digunakan sebagai makanan ternak untuk produksi daging dan susu (protein).
Di daerah tropika sebagian besar populasi manusia hidup dengan tingkat enersi rendah sedang di daerah temperate, tinggi. Enersi yang masuk ke detritus food chain 10 - 15% dari produksi bersih.
Jerami dan daun jatuh ke tanah dan akar-akar merupakan sumber masukan enersi kimia ke dalam subsistem tanah. Jumlah ini umumnya tidak mencukupi untuk memelihara kesuburan tanah pada taraf optimum. Enersi yang masuk ke dalam “detritus food chain” belum banyak diketahui sampai saat ini.
Daur nutrisi/bahan
            Dalam ekosistem terestrial sumber/mineral dari tanah, secara alami status nutrisi dipelihara oleh adanya proses daun Biogeokimia.
Di dalam agroekosistem sebagian besar nutrisi terikut sebagai hasil panen dan tidak kembali lagi secara alami sehingga diperlukan pemupukan. Karena itu daur yang biasa terjadi terputus/asiklik.
Faktor-faktor
            Semua yang berpengaruh terhadap struktur dan fungsi ekosistem berpengaruh pula di sini. Kecuali itu ada faktor lain yang berpengaruh antara lain :
1. Kompetisi (intra/antar spesifik)
2. Pengelolaannya antara lain :
- pembajakan
- pergiliran tanaman
- rotasi pengelolaan
- pembakaran
- pemupukan
- irigasi
- penendalian hama/penyakit
- varietas baru
Dari sekian banyak pengelolaan itu sebagian besar telah dibicarakan pada disiplin ilmu lain seperti ilmu bercocok tanam, pengendalian pengganggu dan lain-lain. Untuk tidak mengalami duplikasi maka di sini hanya akan dibicarakan mengenai pengendalian hama/penyakit dipandang dari segi ekologi.
Pengendalian pengganggu
            Apa yang dibicarakan di sini lebih bersifat konsep, sedangkan teori-teori yang lebih mendalam juga praktek-praktek pengendaliannya sudah dibicarakan didisiplin ilmu hama, ilmu penyakit dan ilmu gulma.
Di dunia binatang dan tumbuhan dikenal adanya strategi hidup, yaitu strategi r (pada suatu ekstrem) dan strategi K (pada ekstrem yang lain).
r - diambil dari rumus pertumbuhan populasi
K - diambil dari asimtot atas kurve sigmoid
Ciri-ciri masing-masing adalah sebagai berikut :
- Strategi r : Jenis-jenis kehidupan yang hidupnya opportunis, jadi bersifat :
            - Menempati habitatnya hanya secara tradisional
            - Mobilitasnya tinggi
            - Ukuran tubuhnya kecil, sehingga perlu enersi yang besar. Karena hal-hal di atas,
maka tidak mempunyai mekanisme pertahanan dan kompetisi. Dengan demikian dapatlah dinyatakan hide dan seek.
            - Memanfaatkan habitat secara cepat
            - Adanya reproduksinya besar. Sebagai contoh : lalat, nyamuk.
- Strategi K : yaitu jenis-jenis kehidupan yang menjaga habitat sedemikian rupa agar
tidak rusak,oleh karena itu populasinya selalu di bawah daya dukung habitatnya.
Dengan demikian :
            - Menyesuaikan diri dengan habitat
            - Mempunyai mekanisme adaptasi, kompetisi dan pertahanan
sehubungan dengan strategi hidup kehidupan di atas maka makhluk pengganggu tidak terlepas dari sifat itu. Seorang pemilik perkebunan kopi dan coklat di Afrika yaitu CONWAY (1977) berdasarkan pengalamannya menemukan bahwa setiap cara pengendalian hanya cocok untuk pengganggu dengan strategi hidup tertentu saja. Untuk jelasnya lihat gambar ini:
***


*



     habitat                                                                   reproduksi
***

Gambar 18. Hubungan antara strategi hdup dan efektifitas berbagai metode pengendalian
Dengan gambar tadi jelaslah tidak ada metode yang selamanya efektif kecuali dengan penggunaan pestisida. Oleh karena itulah metode pengendalian dengan penggunaan pestisida sangat disukai tetapi justru inilah yang sangat dirasakan kemudian merusak keseimbangan lingkungan dengan menimbulkan beberapa akibat menurunkannya kualitas lingkungan dalam jangka panjang. Berdasarkan pemikiran dan kenyataan di atas maka kemudian dikembang-kan konsep pengendalian dengan menggunakan semua metode yang mungkin dan penggunaan pestisida sebagai alternatif terakhir.
Penggunaan pestisida dapat dihindari karena :
1. Efektifnya pengendalian alami.
2. Hama/penyakit/gulma belum merugikan secara ekonomis.
3. Pestisida tidak efektif.
4. Tanaman dapat mengadakan kompensasi terhadap kerusakan.


ads.com